What’s the Point of Finding Cancer Mutations?

Hepatocellular cancer of a liver, magnified 200 times.

Image by BonD80/Shutterstock

Here’s an honest question: What is the point of knowing that a gene called KRAS is mutated in many colorectal cancers? Or knowing that p53 is mutated in several types of cancer? Or knowing any of the hundreds of genetic mutations that appear in tumor cells across the land? Unless you work in an academic or industry laboratory, what is the use of knowing the genetic mutation responsible for a cancer? For almost every known cancer mutation, there is no drug to match it with.

The understanding that genetic mutations are linked to cancer is decades-old; the first human oncogenes (genes that trigger cancer) were found in the early 1980s. The exponential growth of cancer genomics is the legacy of the Human Genome Project and spin-off projects like the Cancer Genome Atlas, a publicly funded, collaborative project to parse the genetic underpinnings of cancer, as well as technological advances that allow rapid extraction of genetic information. A single DNA sequencer can now accomplish in a day what took 10 years for the Human Genome Project—and for thousands of dollars per genome, versus $100 million in the olden days of the 1990s. The deluge in genetic information will continue for some time.

The most famous abnormalities are variations of the BRCA gene known as BRCA1 and BRCA2, which can gravely increase the risk of breast and ovarian cancer. These mutations are usually inherited. But cancer genomics has uncovered hundreds of genetic mutations that arise spontaneously during a lifetime. These abnormalities can’t be predicted or prevented—or, on the plus side, passed on to one’s children. There’s SF3B1 in myelodysplastic syndrome, a type of blood cancer. Abnormalities in a gene called FLT3 (pronounced flit-3) are common among patients with acute myeloid leukemia. Many brain tumors have abnormal IDH1 genes. Mutated versions of MLL2 and MLL3 have been found in medulloblastoma, non-Hodgkin lymphoma, prostate cancer, and breast cancer (PDF). And on and on.

Science has come far in deciphering not only what genes are mutated in what cancers, but also how and when the changes arise. The knowledge is remarkably specific. According to recent research, the most common solid tumors (that is, cancer that occurs as clusters of cells in or on organs, rather than in liquid form within the blood or lymphatic system) have up to 66 mutations that influence how the cancer cells operate—how fast they divide, whether they are susceptible to the signals that would normally cause a cell to die, when they detach from the main tumor to colonize another organ in the body, when and where they attach blood vessels to healthy tissues. Most of the functions that allow cancer cells to flourish are made possible by genetic mutations.

All told, about 140 genes have been found that, when mutated, can drive the development and progress of cancer. These are the “driver mutations,” which are often accompanied by “passenger mutations,” abnormalities that occur as cancer progresses but do not spur the disease. Most tumors contain fewer than 10 of the driver mutations, but the number of total mutations—passenger and driver—can climb far higher, from a dozen or so in neuroblastoma to approximately 200 in lung cancer.

The reason cancer-causing mutations occur follows a cold logic. Simply, it’s largely a matter of odds. When a cell divides, its DNA double helix unzips so that the genome can be copied, one for each of the daughter cells. (Here’s an explanation in rap.) Our genetic information is encoded by the nucleotides thymine, cytosine, guanine, and adenosine, abbreviated as T, C, G, and A, respectively. Each of our 20,000 or so genes is made up of a sequence of those bases. Strung together and squished into chromosomes, our genome contains a total of 3 billion bases. The Human Genome Project produced reams of data that look like this: TCGGGAAATTCGATCCCCAAAATTCTA, etc. (You can see genetic sequences online here.)

That’s the miracle of life, or one of them. Every single cell in our bodies contains a complete copy of the human genome. If you unwound the DNA from all these cells, it would reach to the sun and back 400 times. And every time a new cell is made, which is often—about 10 trillion times in a lifetime—the genome is copied, from the moment of conception to the moment we shuffle off this mortal helix.

That’s a lot of T’s, C’s, G’s, and A’s, and sometimes mistakes happen during replication. Sometimes a C is substituted for a G. Sometimes a few bases don’t get copied. Sometimes a sequence of a few bases gets copied in reverse order. That’s what genetic mutations are. Errors.

Sometimes the change, even of a single base, is enough to cause damage. The mutant gene—APC in colon cancer, for example—encodes a mutant protein that enables the single cell housing the mutation to grow at a faster pace than any of the cells surrounding it. At first, the change is minimal. But with cells growing and dividing more rapidly, the odds of another mutation are higher. So then one day, a cell with the APC mutation also gets a KRAS mutation, and now the dually mutated cells grow even faster. Soon enough, one of those cells gets a PIK3CA mutation, and now the cell is able to burrow into the colon walls, or find its way to a lymph node, or depart the mother ship for the liver.

It’s a matter of odds: The more cells you have, the greater the chance of a mistake, and the more mistakes that occur, the more likely it is that one of the mistakes will be harmful. Environmental influences may increase the likelihood of mutations. But so far, cigarette smoking is the only factor that is beyond debate. The fact is that because cancer cells reproduce more rapidly than any other cell in the body, mutations occur in cancer cells in far greater numbers. Before long, the cancer cell is abnormal enough that it takes on behaviors that eventually kill us.

That’s cancer. That’s all it is. It’s the result of speeding up a perfectly normal bodily process. As George Johnson puts it in The Cancer Chronicles, “Cancer is not a disease. It is a phenomenon.”

And that is why cancer genomics matters: not because of the information, but because of what the information tells us about this disease, which is diagnosed in about 12.7 million people worldwide every year. Keeping up with the information for information’s sake is futile and pointless for most of us. But taken together, the findings call for a shift in our overall thinking about cancer. That change in perception matters when it comes to understanding why so many members of the human race, let alone one’s family, continue to die of cancer. 

Source: http://www.slate.com/articles/health_and_science/human_genome/2013/10/cancer_mutations_genetic_studies_of_tumors_have_not_led_to_many_drugs.html
Related Topics: Fantastic Beasts and Where to Find Them   Chobani Recall   12 Years a Slave   diana nyad   Espn.com